mir-79
Fly Line IDF001943
Construct IDP003396
CG/CR NumberCR43019
Symbolmir-79
Gene Namemir-79
Gene Synonyms
FBgnFBgn0262452
TypemiRNA
PlasmidpWALIUM20
Sequence

TGAAGCTGACTTGCCATTGCTTTGGCGCTTTAGCTGTATGATAGATTTAA
ACTACTTCATAAAGCTAGATTACCAAAGCATTGGCTTCTGCAGGTCA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items