mir-964
Fly Line IDF001958
Construct IDP003414
CG/CR NumberCR42950
Symbolmir-964
Gene Namemir-964
Gene Synonyms
FBgnFBgn0262243
TypemiRNA
PlasmidpWALIUM20
Sequence

CAATAACATATTGGTCCAACTTGCCTTAGAATAGGGGAGCTTAACTTATG
TTTTTGATGTTTAAGTTAAAAGCCTCTGTTCTAAGACAATTTGATGATCA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items