mir-995
Fly Line IDF002013
Construct IDP003446
CG/CR NumberCR42892
Symbolmir-995
Gene Namemir-995
Gene Synonyms
FBgnFBgn0262185
TypemiRNA
PlasmidpWALIUM20
Sequence

CACCTGCACCCCGCAGCCCGAATTATGTGGGAGCTGCGCCGTTTCCGTAA
TCCGTAGCACCACATGATTCGGCTTCGTGGTACAGGATAT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items