lateral muscles scarcer
Fly Line IDF004845
Construct IDP003243
CG/CR NumberCG13424
Symbollms
Gene Namelateral muscles scarcer
Gene SynonymsCG13424; lms
FBgnFBgn0034520
TypeORF-VN
Plasmidin vivo tag swap
Sequence

ATGCTCCGCATATTCAAATTAGTTTTCCGTAAGATCTCGACGCGCGCTGT
TGTCTCCGGAATATCTTCAAAATATATATCGCTCGCAATCGGCGGAAACA
TGAATTCGCAATCGGCAGTGCGTCGCTATCCACACAGTTTTTCCATCGAA
CAAATTCTGGCCAAGCCGGAAATGCGCAGCTCCACTTCCTTTGAGGACTC
CGTGCAGGATGAAAGCGGTCGCGGTGGCAATTGTCTCGGTGCTTCACGGG
CTTCCAGTCCGGCAACATCGAGTTGCTTGGATGACAACATGGACGACGGC
AAAAGTGATATCGATTTGGCCTCAGATGATGGAAACGGCCTTGGTGATGA
CCGCAAAAAGCGACCGCGTACCGCCTTCTCGGCAGCTCAAATCAAAGCAC
TGGAAACGGAGTTCGAAAGGGGAAAGTATCTTTCGGTGGCGAAGCGAACT
GCACTGGCCAAGCAGCTGCAGCTCACAGAAACGCAGATCAAGATCTGGTT
CCAAAACCGCCGCACCAAGTGGAAGCGCAAGTACACCTCGGACGTCGAAA
CGCTGGCCTCGCACTATTACGCCCAGCTGGGTATCGGGGGATTGGCCAGG
CCGATGGTGGTTGGTGATCGCCTCTGGCTCTTCAGCCAAACGCCAACGGG
TCCCACGCCCATTCAGTCCATTATGCTAAATGGCAGTGGCTCCGCTGCAC
CCATGGCCTCAGCAACGACGGCCACCGGCTCACCCATGCGTCCGTACGCG
ACTAGCGGCGGAATGCCACCGTTGCCGGGTCCCAGTGTGATGGAGAGTGC
CCGTAATGCCATACTGGCACGTGGACAACCCTTGAACTTCGCCCTGCCCT
TTGGCGTGGCTAAGCCGCCGGCGGGTGGTGTGCCTGCGGCCAGCTACATC
CCTCGCTGCAAGCCGTATGCGGCCAGCTATGTGGACTACGCGGCGTCACT
GCCAACGAACGAGAGCTATCTGCAAATGAAGTACGCGACGCTGCCGCCGG
AAGCGGAAAGTGGCGCCTCCAATGGCCTCGCCGAACTGGAACGCGTCTTT
GGGGATGCCAATGCCAACTTTCTGCAACAACGCAGCACGCCAGTCACTGG
AACAGCCACAGCCTACGGCCACGATGGATTGAATCAGGCGCAGCGGAGCC
GCAGACCCACACAATCGGAGTCCGAGTGCAGCGACATTGACTGCGAGCAT
CTGGACGAGGATGAGGAGCCACCTGCTGCGGAG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items