Androcam
Fly Line IDF002629
Construct IDP004591
CG/CR NumberCG17769
SymbolAcam
Gene NameAndrocam
Gene SynonymsAcam; Camr97A; ACaM; CG17769; And
FBgnFBgn0011273
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTCCGAACTAACGGAGGAGCAGATTGCCGAGTTCAAGGATGCCTTTGT
CCAGTTCGACAAGGAGGGAACCGGCAAGATCGCCACCCGTGAGCTGGGCA
CATTGATGCGCACCTTGGGCCAGAATCCAACGGAGGCCGAGTTGCAAGAT
TTGATAGCTGAGGCCGAGAACAACAACAATGGCCAACTGAACTTCACTGA
GTTCTGCGGTATAATGGCCAAGCAAATGCGGGAAACTGACACTGAGGAGG
AAATGCGTGAGGCATTCAAGATTTTTGATCGTGATGGCGATGGCTTTATA
TCACCAGCTGAGCTTCGCTTTGTGATGATCAATCTGGGCGAAAAGGTCAC
CGACGAGGAGATCGATGAGATGATTCGCGAGGCTGATTTTGATGGGGATG
GCATGATCAACTACGAGGAATTCGTATGGATGATAAGCCAGAAG

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items