Myb oncogene-like
Fly Line IDF000146
Construct IDP000469
CG/CR NumberCG9045
SymbolMyb
Gene NameMyb oncogene-like
Gene SynonymsdMyb; Dm-Myb; DmMyb; dmyb; MYB; myb; Dm myb; dmMYB; c-Myb
; p85; DMyb; Dm-myb; CG9045; Dm Myb; D-myb; DmMYB; c-myb;
l(1)XVI; Myb; Dmyb
FBgnFBgn0002914
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGCAAGTGCGAGCACTGAAAACGGCGAGGAGCTGATGAATTACGGCAG
CAATTCGGATTCGGAGGAGTCCGAGTACTCGGAGAACGAGGATACCCAAG
TTTGCGACAAGGATTCACAACAGAACAGCAATGCCGATTCGGGCTATCCA
CTGGACTCGCCCGAACTACAGGACTCCAAGACGACGGGGCAAAAGGGACA
GAACAAAAGCGGTAAAACTAGCATCGGTGCAGTGCATCCGAACTATGGAT
TCGGCAAACGCTGGTCCAAGTCCGAGGATGTGTTGCTCAAGCAGCTGGTG
GAGACGCACGGTGAGAACTGGGAGATTATCGGACCGCATTTCAAGGATCG
CCTGGAACAGCAAGTGCAGCAGCGTTGGGCCAAAGTCCTCAATCCGGAGC
TAATCAAGGGCCCGTGGACGCGGGACGAGGACGACATGGTTATTAAGCTG
GTGCGCAACTTCGGGCCCAAGAAATGGACACTAATTGCACGATATCTGAA
CGGACGAATTGGGAAACAGTGCCGCGAGAGATGGCACAACCACCTCAATC
CGAATATCAAGAAAACGGCCTGGACCGAAAAGGAGGACGAGATTATCTAC
CAGGCTCACTTGGAGCTGGGCAACCAGTGGGCAAAGATTGCCAAACGTCT
GCCCGGACGCACCGATAACGCCATTAAAAACCATTGGAATTCAACAATGC
GTCGCAAATATGACGTCGAACGCAGATCGGTTAATGCATCTGGTAGCGAT
TTGAAGAGTTCGCGAACCCATCTCATCACGCTGATCAAGTCCGGTGGCAT
CAGCAAGTGTATGAATAATATGCAACATAACAAGGAATCTGGTGGTGAGG
CAGTTAATAAATCCGAAAACGCCGATGGCGCTTCGGTTACTGCCGTGAAA
GGTGGTGATCTGGCACAGGAATCACAAGACGATCATCAAAAGGGATCCAA
TCTGGCACACCTCAGTATGCAGCATCTCATTAAGTTGACCATGCCGCGCC
AAACACCGATCATATTGAAGCGTACACGCAAACACATTCCCGAAACTCAC
CATCAGGCAGGATGTTCATCAAGTGAGACATTCAACCAGGAAGAAGCCGC
CGGAAACGCCAGGTCGCGACCACCGAGTTCGCCCGTCATATCGCCCATTA
AGTCGCTACCCTTTTCACCGAGTCACTTCCTCAAGTCGCCTTGCCTGACC
ACCTTTGAAGATATGGATCTGCGGGCTAGCACGCCGGTAACCAAGGTCTA
TAATCGCGTTGGAATGGAGATCAAAAAGGAAATGGAGACATCGTCGATAG
AAACTCCACACAAGAGTCAACTTGGACCACGAACACCAACGCCCTTCAAA
AAGGCACTTGCTGCCATCGGCAAGAAGAGGGACGGTCGTCGATACGAGCC
CTCCAGCCCATCCAGTCTGGTGGAGGATCTGGCCGAAATCATCCATGAAG
AGCATCTGAGCAACTCGCTGACCGCAAACAATTCCAAAATGATGGGCGCC
GCCGATCAGAACTCAACGCTAAGCACCGAATACAATGCTCAGTCGCCGCC
GCATATGAAACGTGCCAGGAAGTCATTGCTCTCAACTTGGAGCTCCAATC
ATCCATACAACGCTGGCTCCGCCAAGAGGATTCAACCCTTCGAAACCGAG
ACGCCCAGCAAGTTTCTCACATCGCCGGGCGATATTTTGAAGGACACGCT
GTGCAGCGAACAGGACCTGCCGTTCGACGAGGGCAGAAAGGAGAATCGAC
CATTCCATAATCGCAGAATTAACAAGTACCGCGGTGGCTTGACCTACGAT
CATGTCATTGATCCCAAGTGGGCACGCGTCGCTTGTGGCAAGTCCAGAGA
TCAAATGTTTATGGAGGAGCAGGCTTATGCGTGCCTCAAAAATCTGTCCT
GTATTTCGCGCTCCCTGAACTTCGAGAAACAAAAGTGTTTGGTGAATTCG
TTCGACCGCTTTGGTTCGCTC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items