SoxNeuro
Fly Line IDF000152
Construct IDP000422
CG/CR NumberCG18024
SymbolSoxN
Gene NameSoxNeuro
Gene SynonymssoxN; Sox B1; CG18024; SOXB1; SOX29F; DM64; Sry-rDM64; So
xN
FBgnFBgn0029123
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTGACCATGGAATCGGATATGAAAGGCAGCCTGCTGCATGCCACCAT
GCCGCCGCATCACACAAGTGCCGCGTTGCACGGACATGCGGCATCGCCGT
ACTCCGCCCTAGCTCCCCTTATGAACCTGGGCCAGTCGCACCTGACCCAC
TCGCAGCTGAGCCATCACAACCACCATCATCACCACATGAGCGCCCATAT
CGCGGCCAGCCAGAGTCCCAATCCGCTGAGCTCGCTGCAGTCCTCGATGG
CGAACACCCTCAATGGCAGCCAGGTGGGGCAGCAGCAGCAGCAACAGCAG
CAGCAGCAGAGCTCCCCGCTGCACAGCTCCAGCGAATTGAGTCCCACCCA
GAGCAGCATCGGAAGCCATCACATGACATCGCCGGTCAGCCACCAGCAGC
ACACGCAACAGCAGCAGCACGGGCAGCAGCAGCATCTGGGCGCGGGATCT
GCATTGAGCAGCCTAACTGGAGGATCCAGCAACAACAACAACAACAGCGC
CACGGCCAACAAGAACCAACAGCACGCGGATCGTGTGAAGCGGCCTATGA
ATGCGTTCATGGTTTGGTCACGGGGCCAGCGGAGGAAGATGGCCTCGGAC
AACCCCAAGATGCACAACTCGGAGATCTCGAAGCGACTGGGCGCCCAGTG
GAAGGACCTCTCGGAATCGGAGAAGCGACCGTTCATCGACGAGGCCAAGC
GCCTGAGGGCGGTGCACATGAAGGAGCATCCGGACTACAAGTACCGGCCG
CGCCGCAAGACTAAAACGCTGACCAAGACCAAGGAGAAGTACCCAATGGG
CGGCCTGATGCCCGGACAGACGGTGGGCGGCGGAGCACCGGGTGAGCCGG
TGACGCCCACGCGGGTGCAAGGTCAGCCTGGCCAGAACCAGTCGCTAAAC
GGTAGTGGAGGCAGTGCAGCAGCGGCAGCGGCGGCGGCAGCAGCGGCAGC
GCAACAGGCGCGCCAGGATATGTACCAGATGAACGCGCCCAATGGATACA
TGCCCAATGGCTACATGATGCACGCAGATCCGGCCGGAGCGGCAGCCTAT
CAGACCTCCTACATGGGCCAGCACTACGCGGCGCAGCGGTACGACATGGG
ACACATGTACAACAACGGGTATGCGATGTACCAGACGGTGTCCGGCGGAC
AGACATCGCCGTACGGCAGCAGTCTCCAGCAGCCCGGATCACCGTCGCCG
TATGGCGGCAGTAGCTTGCAGCAGCAGCCCGGCAGTCCGACTCCGTACGG
CGGAGGTGGAGGCGGTGGCGGTCAGGTTTCCTGCCAGAGCCACAGCCCCA
GCGACTCGAGCATCAAGTCCGAACCGGTGTCGCCCAGTCCCAGTGCCATA
GCGCTCAACAACAACAACAACATCAACAACAATCACATCATGAAGCGGGA
ATACAGCTCTGCAGCGGCGGCAGCAGCAGCAGCAGCAGCGGCAGCAGCCG
CCGGCGGCGGCGAGCTGAATCACCTGATGAATATGTACCATCTGCCGGAT
GAGCAGCGCCACCTGCTGCACTATCAGACTGACTCGCCCGATCTGCAGCA
GCAGCACCAGTCGATGCAACAGCAGCAGCAGCACCTCCCGCAGCAACACC
TTTCGCAGCAGCACCAACAGATCCCGCAGCAACACCATACCATGCAGCAG
CAGCAGCAGCAACACCACCTGCAGCATCAGCAATCGCTGAGGGCGATGGC
GCCGCTGGCACACATG

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items