Jun-related antigen
Fly Line IDF000089
Construct IDP000044
CG/CR NumberCG2275
SymbolJra
Gene NameJun-related antigen
Gene SynonymsJra; jun; Djun; AP-1; Jun; JRA; DJun; DJUN; D-jun; c-Jun;
D-Jun; d-Jun; jra; d-jun; AP1; cJun; CG2275; dJRA; dJun;
l(2R)IA109; dJUN; l(2)IA109; dm-Jun; dAP-1; d-JRA; dJra;
V; l(2)46Ef; D-jun/Jra; djun; JUN
FBgnFBgn0001291
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGAAAACCCCCGTTTCCGCTGCTGCGAACTTAAGTATTCAGAATGCTGG
CAGTTCCGGAGCAACTGCCATTCAGATCATACCTAAAACCGAGCCCGTTG
GAGAAGAAGGCCCCATGTCACTGGACTTTCAGTCGCCGAACCTGAACACA
TCCACCCCGAATCCTAACAAGCGTCCCGGCTCGCTGGATCTGAACAGCAA
GAGTGCCAAGAACAAGCGCATCTTCGCACCACTGGTCATCAACTCACCGG
ATCTGTCATCCAAGACGGTAAACACACCCGATTTGGAGAAGATCCTGCTA
TCCAACAATCTGATGCAAACACCGCAGCCGGGAAAGGTGTTCCCCACCAA
GGCGGGGCCCGTCACCGTGGAGCAGTTGGACTTCGGCAGGGGATTCGAGG
AGGCCTTACACAATCTTCACACTAACTCCCAGGCATTTCCGTCCGCCAAT
TCCGCCGCTAATTCCGCCGCCAATAACACAACTGCGGCAGCCATGACAGC
GGTGAACAATGGCATCAGCGGAGGCACCTTCACCTACACCAACATGACCG
AGGGCTTCTCGGTGATTAAGGACGAGCCCGTCAATCAAGCCAGCTCGCCC
ACCGTTAATCCCATTGACATGGAAGCGCAGGAGAAGATCAAGCTGGAGCG
CAAGAGGCAGCGTAACCGTGTGGCTGCATCCAAGTGCCGCAAGCGCAAGT
TGGAGCGCATCTCAAAGCTGGAGGATCGCGTGAAGGTACTTAAGGGCGAG
AACGTCGACCTGGCTAGCATCGTGAAGAACCTCAAGGACCATGTGGCGCA
GCTGAAGCAGCAGGTGATGGAGCACATTGCCGCGGGCTGCACGGTGCCGC
CGAACTCGACAGACCAA

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items