CG9215
Fly Line IDF000138
Construct IDP000412
CG/CR NumberCG9215
SymbolCG9215
Gene NameCG9215
Gene SynonymsCG9215
FBgnFBgn0030659
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTCCAACAACCTGCAGCCGCGTGTGGTGGACCTGGGCGTGGCTTGCCT
GGTCTGCCTGGCGGAGGAGCCCGAGGCCAGCTCGATCTATGGCCACGACC
CGGAGTCTCCTCATATGCTCATCCTGGACAAGATTCGCTGCTGCACCAGC
CTGCAGCTGGACAGCAGCCCGTCGCAGCTGCAGCGCTGGCCGGACAAGAT
CTGCAAGCAGTGCCATCTGGAGCTGTCCGTCTCTTATCGCTTTCACGAAA
AGTGCACCGCTGTCCAGAAGCTATTTCGCTCCGCCAGCCGCTCTACCTCG
ACCTCCGCCGTCTTCGCCGCCGCTGCTGCTGCTCCTCCTGCCCCTATGCT
GGTCGATAAGCAGCAGGAGCAGCTTAAGCTTGATCTGGAACAGGCTCACG
TTCGGCTGCCAGCAACACTGAAAATAAGGAGGCTCAACGTGGAGCCCTGC
TCTTCCAGTTCAGTAAGCGGTACAATAACTACCAGCACGGAGCCCTCCGA
GGATGTCAAGGAGGAGAAGACCGATTCACTATCCCTGATACCAGACGGAG
CGATGGTCCTATCCCTGAATGACTTTCAAGCGCAGGATTCTATTACTCAG
CAGGCAGAAGAAAAGGACCCTAAAAAACAGCAGGATGAGGATGAGGGGCA
GGCCAAGATGCTGGAACTGGATCCTTGGGATGACGAAAACACGCCGGAGC
ATCTGTACGAGATCGAGACTCCGCTCATCGAGGAGTCTGTGGTGGCCAGT
CCGCCGTTGCCGTTGCCGCCTACTCATCCCGCCAACCAGCAGAAAAAGCG
CACCTACCGTCGCGTTTCGCCCAATGTGAAGCATGAAAAACTGACGGCGA
ACGTGGACGATGATTTTAAGGCCGGTTCCACGACCAAACGCCGCAACTGC
GAACGCTCGCCAAAGATCTGCGATGTTTGCGGTAATACATACAAGTACCA
GCACGCGCTAAATGCCCACATGCGGCGTCACAACAACGAGCGCCCATATT
CCTGCGAGGTGTGCCAGAAGGCGTTCATCTCAAACGTTGAGCTGCGACGC
CACATGCGCGTCCATACCGGCCAGAAGCCCTACAGCTGTCGGCACTGCGA
GCGTCGTTTCTCGGACTTTGGCAGCAGCAAGAAGCACGAGAGGATCCACA
CCGGCGAGCGGCCGTATGTGTGCGAGGTGTGCAACAAGGGATTCGCCTAT
GCTCACGTTCTGTCCGCCCATCGGCGGACGCACACCGGCAAGAAGCAGTT
CCAGTGCACGCAGTGCGACAAGGGTTTCACCAAGAAGACCTATCTGTCGG
CTCATATGGAACAGCACCGAGGCTCGGGCAACGGCGAGGCATCGGTCGCA
TCATCATCCGCTGATGCATCCAGTCGCAACCAGAATGCCTCCGCACGGAA
GGAGTCAGCGCGCAAGCAACAGCAAATCCCCGAGTCCTTTTCGCTGGACT
CCGTAGAGCTGGAGCAGACAAAGGTTCTCGAGGAGTGCATTGTGGCGAAT
GACTTCATGTTCAACGAGGAGGACAACGCGGAGCAGGAGGCCAATGACCG
CGAAGGGCTGCAGCATGACGATTCCTACCCGTACGTCGGTGGCTACCAGA
GCGTTGACTCTGTCAAGGAACTGGTCGGCGATCTGCTGGACACCGAGGAG
TTCTGTGACGAATCCAAGTACATGATAGAA

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items