crocodile
Fly Line IDF000139
Construct IDP000384
CG/CR NumberCG5069
Symbolcroc
Gene Namecrocodile
Gene SynonymsDmfd1; FD1; fd78E; fd1; CG5069; croc; FoxC
FBgnFBgn0014143
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCATACGTTATTCAGCGACCAGAACTCCTTTACGCGCCACTATGCCCA
GACCGCAGCCGGTTACGGATCCGCATCCGCGGTGGCGGCGGCCAGCAGCG
CCTCCGCTGCAGCAGCGGCACATTACGCATACGACCAGTACTCCCGCTAT
CCGTACTCGGCCAGCGCCTACGGCCTGGGTGCCCCGCACCAGAACAAGGA
GATTGTAAAGCCACCTTACTCGTACATCGCCCTGATAGCCATGGCCATCC
AGAATGCGGCGGACAAGAAGGTGACCCTGAACGGGATCTATCAGTACATC
ATGGAGCGATTTCCCTACTATCGCGACAACAAGCAGGGCTGGCAGAACTC
CATTCGGCACAATCTTAGCCTCAACGAGTGCTTCGTGAAGGTGGCCCGCG
ATGACAAGAAGCCCGGCAAGGGCTCCTACTGGACTCTGGATCCGGACTCC
TACAACATGTTCGACAACGGCTCCTTCCTTCGCCGGCGTCGCCGCTTCAA
GAAGAAGGATGTGATGCGGGAGAAGGAGGAGGCCATCAAGCGGCGGGCCA
TGATGAACGAGAAGCTGGCCGAGATGAAGCCCCTCAAGCTGATGACCAAC
GGCATACTGGAGGCCAAGCACATGGCCGCCCATGCTGCCCACTTCAAAAA
GGAGCCCCTAATGGACTTGGGTTGTCTAAGTGGCAAGGAGGTCTCCCATG
CCGCAATGCTCAACTCCTGCCACGACAGCTTGGCCCAAATGAACCACTTG
GCTGGCGGCGGAGTGGAGCATCCCGGCTTCACCGTGGACTCACTCATGAA
TGTGTACAACCCGCGGATCCATCACAGCGCCTATCCCTACCACTTGAACG
AGGACAACTTGGCCACGGTGGCCAGCAGTCAGATGCATCATGTCCACCAC
GCTGCGGCGGCCCATCATGCCCAGCAACTGCAGCGTCATGTGGCGCACGT
GGCCCATCCTCTGACCCCCGGCGGCCAAGGAGCGGGAGGCCAATCGTCCG
GACACTCGCCCACCACGATCTCAACTCCGCATGGTCCCGCGCACGGGGGT
TGGTATACCCCGGAAACGCCACCATCGGAACCCGTTCCTCACAATGGGCA
GCAGGGCACACCCACCCACCCGGGACATAATAACAACAACAGCAGCAGCG
TACTCAACCACAATGGAGTGGGCAACGGTGGCGGAGGCGGCGGCGGTGGC
GGTGGAGGATCCTCCAGCGTGCTGACCAGCAGTCCCACATCGGCACTGGG
TTTCCGCGACATGATCTTCGAGCAGAACCAATCCTGCCAACTGGACACCG
GTAGTCCCACCGGCAGCCTACAATCCGCCAGTCCACCTGCCTCCGCATCC
GTGGCAGCGGCATCAGCGGCAGCAGCGGCGGCGGTGATCAGTAGCCACCA
CCACCACCATCATCACCATGCGGCGCTTAGCGGGAACCTGGGCCAGCTGG
GTCAGCTGAGCAATCTGAGCCACTACCGACCGCATGTGGGCCACTACCAG
GAGTACGGCATCAAGTACGGGGTG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items