E2F transcription factor 2
Fly Line IDF000069
Construct IDP000055
CG/CR NumberCG1071
SymbolE2f2
Gene NameE2F transcription factor 2
Gene SynonymsdE2F2; dE2f2; de2f2; E2F2; E2F; dE2F-2; CG1071; E2f2; e2f
2
FBgnFBgn0024371
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGTACAAGCGCAAAACCGCGAGTATTGTTAAAAGAGACAGCTCCGCAGC
GGGCACCACCTCCTCGGCTATGATGATGAAGGTGGATTCGGCTGAGACTT
CGGTCCGGTCGCAGAGCTACGAGTCTACACCCGTTAGCATGGACACATCA
CCGGATCCTCCAACGCCAATCAAGTCTCCGTCGAATTCACAATCGCAATC
GCAGCCTGGACAACAGCGCTCCGTGGGCTCACTGGTCCTGCTCACACAGA
AGTTTGTGGATCTCGTGAAGGCCAACGAAGGATCCATCGACCTGAAAGCG
GCAACCAAAATCTTGGACGTACAGAAGCGCCGAATATACGATATTACCAA
TGTTTTAGAGGGCATTGGACTAATTGATAAGGGCAGACACTGCTCCCTAG
TGCGCTGGCGCGGAGGGGGCTTTAACAATGCCAAGGACCAAGAGAACTAC
GACCTGGCACGTAGCCGGACTAATCATTTGAAAATGTTGGAGGATGACCT
AGACAGGCAACTGGAGTATGCACAGCGCAATCTGCGCTACGTTATGCAGG
ATCCCTCGAATAGGTCGTATGCATATGTGACACGTGATGATCTGCTGGAC
ATCTTTGGAGATGATTCCGTATTCACAATACCTAATTATGACGAGGAAGT
AGATATCAAGCGTAATCATTACGAGCTGGCCGTGTCGCTGGACAATGGCA
GCGCAATTGACATTCGCCTGGTGACGAACCAAGGAAAGAGTACTACAAAT
CCGCACGATGTGGATGGGTTCTTTGACTATCACCGTCTGGACACGCCCTC
ACCCTCGACGTCGTCGCACTCCAGCGAGGATGGTAACGCTCCAGCATGCG
CGGGGAACGTGATCACCGACGAGCACGGTTACTCGTGCAATCCCGGGATG
AAAGATGAGATGAAACTTTTGGAGAACGAGCTGACGGCCAAGATAATCTT
CCAAAATTATCTGTCCGGTCATTCGCTGCGGCGATTTTATCCCGATGATC
CGAATCTAGAAAACCCGCCGCTGCTGCAGCTGAATCCTCCGCAGGAAGAC
TTCAACTTTGCGTTAAAAAGCGACGAAGGTATTTGCGAGCTGTTTGATGT
TCAGTGCTCC

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items