armadillo
Fly Line IDF001215
Construct IDP002982
CG/CR NumberCG11579
Symbolarm
Gene Namearmadillo
Gene Synonyms
FBgnFBgn0000117
TypeORF-3xHA
PlasmidpUASg-HA.attB
Sequence

ATGAGTTACATGCCAGCCCAGAATCGAACCATGTCGCATAATAATCAATA
CAATCCACCTGATCTGCCGCCGATGGTATCCGCCAAGGAGCAGACCCTCA
TGTGGCAGCAGAATTCGTACTTGGGCGACTCCGGCATCCACTCGGGTGCC
GTGACCCAGGTTCCATCGCTGTCTGGCAAGGAGGACGAGGAGATGGAGGG
AGATCCACTTATGTTCGACCTGGACACCGGTTTCCCGCAGAATTTCACAC
AAGACCAAGTGGACGATATGAACCAGCAACTGAGCCAGACACGCTCCCAA
CGTGTACGTGCTGCCATGTTTCCGGAAACCCTGGAGGAGGGCATTGAGAT
TCCCTCCACCCAGTTTGATCCCCAACAGCCGACGGCAGTGCAACGTCTTT
CGGAACCGTCACAAATGCTAAAGCACGCGGTGGTCAATCTGATCAACTAC
CAGGACGACGCTGAGCTGGCAACCAGGGCCATACCCGAGTTGATCAAGCT
GCTGAACGATGAGGATCAGGTGGTAGTTTCCCAGGCCGCCATGATGGTCC
ACCAGCTGTCTAAGAAGGAGGCCTCGCGACATGCCATTATGAACAGCCCT
CAGATGGTAGCCGCTTTGGTGCGTGCCATCTCTAACAGCAACGATCTGGA
GAGCACCAAGGCAGCGGTAGGAACACTGCACAACTTATCACACCATCGCC
AGGGTCTGCTGGCCATCTTCAAGAGTGGCGGCATCCCGGCACTCGTCAAG
TTGCTCTCCTCGCCAGTGGAGAGTGTGCTGTTCTATGCAATTACCACTCT
GCACAATTTGCTGCTCCACCAGGATGGCTCTAAGATGGCTGTGCGCCTGG
CCGGCGGGCTTCAGAAGATGGTTACTCTGCTGCAACGAAACAACGTTAAG
TTTCTGGCTATCGTCACAGATTGCTTGCAAATTCTGGCCTATGGTAACCA
GGAGAGCAAGTTAATAATTCTTGCCTCCGGAGGGCCCAACGAACTCGTGC
GCATTATGCGCTCCTACGACTACGAGAAGCTTCTGTGGACCACTTCGCGG
GTACTGAAAGTGCTCTCCGTTTGCTCCAGCAACAAGCCGGCCATCGTGGA
TGCCGGTGGAATGCAGGCGCTGGCTATGCACTTGGGTAACATGTCACCGC
GCCTTGTGCAAAACTGTTTGTGGACGCTCCGCAATCTTTCGGATGCAGCC
ACTAAGGTGGAGGGCCTTGAAGCTTTGCTCCAATCTCTCGTCCAGGTTCT
GGGCTCGACCGATGTCAACGTGGTCACCTGTGCCGCCGGTATCCTTTCAA
ATCTGACGTGCAACAATCAGCGCAACAAGGCCACCGTTTGTCAGGTGGGC
GGTGTGGACGCCCTCGTCCGTACTATTATCAATGCTGGAGATCGCGAAGA
GATTACCGAGCCGGCTGTATGTGCCCTGCGTCACTTGACCTCGCGTCATG
TGGACTCTGAGTTGGCCCAGAATGCCGTACGCTTAAACTACGGACTATCG
GTGATTGTAAAGCTATTGCATCCACCATCACGCTGGCCCTTGATCAAGGC
CGTCATTGGACTCATACGCAATTTGGCCCTCTGTCCGGCCAATCACGCCC
CGTTGCGGGAGCACGGGGCCATCCACCATCTGGTGCGACTGCTTATGCGC
GCCTTCCAAGACACAGAGAGGCAACGTTCCTCGATAGCCACCACTGGTTC
ACAGCAGCCGTCCGCATACGCTGACGGCGTTCGCATGGAGGAGATTGTCG
AGGGCACGGTGGGGGCGCTACATATCCTGGCCCGCGAGTCTCACAACCGG
GCACTCATTCGCCAGCAGTCGGTAATACCGATCTTTGTACGATTGCTGTT
CAACGAAATCGAGAACATACAGCGCGTGGCTGCTGGCGTTCTTTGTGAGC
TCGCCGCTGACAAGGAGGGCGCCGAGATTATCGAGCAGGAGGGCGCCACT
GGGCCGCTGACCGATCTCCTGCACTCGCGCAATGAAGGCGTGGCCACATA
CGCCGCCGCTGTTCTCTTTCGCATGAGTGAGGACAAGCCGCAGGATTACA
AGAAGCGGCTATCCATAGAGCTGACCAACTCGCTGCTGCGCGAGGACAAC
AACATATGGGCCAATGCCGACCTGGGCATGGGTCCCGATCTACAGGATAT
GCTTGGACCAGAAGAAGCATATGAGGGCCTGTACGGACAAGGTCCGCCCA
GCGTGCACAGTTCACACGGAGGTCGCGCATTCCATCAGCAAGGATATGAT
ACTCTACCAATAGATTCGATGCAGGGTCTGGAGATCAGCAGCCCAGTGGG
CGGCGGCGGTGCTGGCGGTGCTCCCGGCAATGGTGGAGCTGTAGGCGGAG
CTAGCGGCGGCGGTGGTAACATCGGCGCCATTCCGCCTAGCGGCGCACCA
ACTTCGCCCTATTCCATGGACATGGACGTTGGCGAGATTGATGCCGGTGC
ATTGAACTTTGACTTGGACGCCATGCCGACGCCACCCAATGACAACAACA
ACCTGGCTGCCTGGTACGATACCGATTGT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items