upstream of RpIII128
Fly Line IDF001103
Construct IDP003049
CG/CR NumberCG8340
Symbol128up
Gene Nameupstream of RpIII128
Gene Synonyms
FBgnFBgn0010339
TypeORF-3xHA
PlasmidpUASg-HA.attB
Sequence

ATGAGCACAATATTGGAGAAAATCTCGGCCATCGAGTCGGAGATGGCCCG
AACCCAAAAGAACAAGGCCACCTCGGCCCATTTGGGTCTACTGAAGGCGA
AGCTGGCTAAGCTGCGACGCGAACTGATTTCCCCCAAAGGAGGCGGCGGC
GGAACCGGCGAAGCTGGCTTCGAGGTGGCCAAGACTGGAGATGCCCGGGT
GGGATTCGTAGGGTTTCCTTCTGTGGGTAAATCCACACTGCTCTCCAACT
TGGCTGGCGTTTACTCCGAGGTGGCGGCATACGAATTCACAACGTTGACC
ACTGTGCCGGGATGCATTAAGTACAAGGGCGCTAAGATCCAGCTGCTGGA
CTTGCCCGGTATCATTGAGGGCGCTAAGGATGGCAAGGGTCGAGGTCGTC
AGGTGATTGCTGTCGCTCGCACCTGTAACCTCATTTTCATGGTGCTGGAT
TGCCTGAAACCGCTTGGCCACAAGAAACTCCTCGAGCATGAATTGGAGGG
CTTCGGCATCCGGCTTAACAAGAAACCACCAAATATCTACTACAAGCGGA
AGGACAAGGGTGGCATCAATCTGAACAGCATGGTTCCGCAGTCCGAGTTG
GACACGGATCTGGTGAAGACCATTCTATCCGAGTACAAGATCCACAATGC
GGACATCACCCTGAGATACGACGCCACTAGTGACGACCTCATTGACGTTA
TCGAGGGCAACCGCATCTACATACCCTGCATATATCTGCTGAACAAGATC
GATCAGATCTCCATCGAGGAGCTGGACGTCATCTACAAGATCCCGCATTG
CGTGCCCATCTCGGCCCATCACCACTGGAACTTTGACGATCTGCTGGAGC
TGATGTGGGAATACCTGCGACTGCAGCGCATCTACACCAAGCCCAAGGGC
CAGCTGCCCGATTACAACTCGCCCGTGGTACTCCACAACGAGCGCACCAG
CATTGAGGATTTCTGCAACAAGCTGCATCGCTCCATTGCCAAGGAATTTA
AATATGCGCTGGTTTGGGGCTCATCTGTGAAGCATCAGCCACAGAAGGTG
GGCATCGAACACGTTCTCAACGACGAGGATGTGGTCCAGATTGTGAAGAA
GGTT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items