Distal-less
Fly Line IDF000436
Construct IDP001533
CG/CR NumberCG3629
SymbolDll
Gene NameDistal-less
Gene SynonymsDll; dll; l(2)01092; 2.7; Ba; En(Arp); l(2)387; E(Arp); C
G3629; Art; BcDNA:LP01770; dl; DLL
FBgnFBgn0000157
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGGACGCCCCCGACGCCCCGCACACGCCCAAGTACATGGACGGCGGGAA
CACGGCGGCCAGCGTCACGCCCGGCATTAACATCCCGGGAAAGTCCGCCT
TCGTGGAGCTGCAGCAGCACGCCGCCGCCGGGTACGGCGGCATCCGGAGC
ACCTATCAGCATTTCGGACCGCAGGGCGGCCAGGATTCCGGCTTCCCCAG
TCCGCGCAGCGCCCTCGGCTACCCGTTCCCGCCAATGCACCAGAACTCCT
ACTCCGGCTACCATCTGGGCAGCTACGCCCCGCCCTGCGCCAGTCCACCG
AAGGATGACTTCTCCATCTCCGATAAGTGCGAGGACTCCGGCCTCCGCGT
CAACGGCAAGGGCAAGAAGATGCGCAAGCCCCGCACCATCTACAGCTCGC
TGCAACTGCAGCAGCTCAACCGCCGCTTCCAGCGTACCCAATACCTGGCC
CTGCCGGAGCGAGCGGAGCTGGCGGCGAGTCTGGGCCTCACGCAAACGCA
GGTGAAAATCTGGTTCCAGAACCGACGCTCCAAGTACAAAAAGATGATGA
AGGCGGCCCAGGGCCCGGGCACCAACAGCGGCATGCCTCTGGGCGGGGGA
GGACCCAATCCCGGCCAGCATAGCCCCAATCAAATGCACAGTGGCGGTAA
TAACGGCGGTGGCTCGAACAGCGGCTCACCCTCACATTATCTACCTCCCG
GACACAGTCCAACGCCATCGAGTACACCCGTGTCCGAGCTTTCACCTGAA
TTCCCACCAACGGGCCTCAGTCCGCCGACGCAAGCGCCGTGGGACCAGAA
ACCGCACTGGATCGACCACAAGCCGCCGCCCCAAATGACGCCACAACCAC
CTCATCCAGCGGCAACGCTACATCCGCAGACGCACCACCACAACCCGCCG
CCCCAGATGGGTGGCTATGTGCCCCAGTACTGGTACCAGCCCGAGACGAA
TCCATCACTAGTGACG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items