buttonhead
Fly Line IDF000214
Construct IDP001573
CG/CR NumberCG12653
Symbolbtd
Gene Namebuttonhead
Gene Synonymsbtd; BTD; CG12653; Btd
FBgnFBgn0000233
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGATCGATGCGGCCTGCAATTACTTAAATCCCTATGCGCAACAGCATCA
GGCGCAGCAGCAGCAACATGCGCAACATCAGCAACACGCGCAACAACAGC
AACATCATCTGCACATGCAGCAGGCGCAACATCATCTGCACTTGTCGCAT
CAGCAGGCGCAACAGCAGCATATGCAACACTTGACACAGCAACAGCAGCA
GCAGCAACAACAACAGCAGCAACAGCAGCAGCAACAGCAGCAACAACAAC
AGCCGCAACAGCAGCAACATGACTTCCTCAGCGCCGCCGCCCTGCTGTCC
GCCCCACCATCCCTATCCGGCTCGAGTTCCGGCTCCAGCTCCGGCAGTTC
TCCGCTATATGGAAAGCCGCCAATGAAGCTGGAACTGCCGTATCCACAGG
CCTCATCCACGGGCACCGCATCGCCCAACTCCAGCATACAATCGGCGCCA
TCATCGGCCTCCGTGTCGCCCAGCATCTTCCCATCACCTGCCCAGTCATT
CGCCTCCATTTCGGCCAGTCCATCTACGCCCACCACGACCTTGGCGCCAC
CTACAACGGCGGCAGCGGGCGCCCTTGCGGGATCACCCACATCCTCCTCA
CCATCCTCGTCAGCAGCATCGGCTGCAGCGGCGGCAGCAGCAGCTGCGGC
GGCAGCAGCGGACCTTGGAGCAGCGGCGGTCGCCAGTGCCGCCTACGGCT
GGAATACCGCCTACTCCGGATTGGGGCCAGCGAGAAGTCAGTTTCCATAT
GCCCAGTACGCCTCCGATTATTACGGCAATGCGGTGGGCATGTCCTCCTC
GGCCGCTTGGTTCTCGCATCAGGAGCGCCTCTATCAGCCATGGAGTTCAC
AGAGCTATCCGGGCTTCAATTTCGATGACATCGCCTTCCAGACGCAATTG
CAACGCCGCTCCGTTCGCTGCACGTGCCCCAATTGCACCAACGAGATGAG
CGGCCTGCCACCGATTGTGGGTCCGGATGAGCGCGGACGCAAGCAGCATA
TCTGCCACATTCCGGGCTGCGAACGGCTATACGGCAAGGCGTCGCATCTG
AAGACCCACCTGCGCTGGCACACCGGCGAGCGGCCCTTCCTGTGCCTCAC
GTGCGGCAAGCGTTTCTCCCGATCGGATGAGCTGCAGCGACACGGACGTA
CGCACACCAATTACCGCCCGTATGCCTGCCCCATTTGCTCCAAGAAGTTT
TCGCGCAGCGATCACCTCAGCAAGCACAAGAAGACCCATTTCAAGGACAA
GAAGAGCAAGAAGGTACTGGCCGCCGAGGCCAAGGAGCAGGCGGCTGCGG
CGATAAAGCTGGAAAAGAAGGAGAAGAAGTCGGGTAAGCCACTGACGCCA
CCCGTGGAATTCAAGCAGGAGCAGCCGGATACGACACCGCTGGTCAACTA
TGCGCCCTATGCCAATCTCTATCAGCATTCCACATCCGCCGGATCGAGTG
TGAATCCTCCGCCGCCACCGCCGCCGCTCTTCCAGCAGCAAATGACGACG
ACAACATCATCGGCGGCGGCCAGCTTTGTGGAGCAGCCGTGGAGCAGTAG
CAGCAGCCGTGCCATACAACCAGCCACTACCTCAGCCAGTTCATCCTCAT
CCTCCAGCGCCAGTTCCCCAGCGGCAGCGGTCGTTTCTGCCATTGGATCT
GCATCTTCCCCAGCCGCATCAGCCACGGCGCTGGCCCAGCATCATTATGC
CGCACTTGCCATGCAAAGTGAGTCCCAGCTGGCGGCGGAATATGGGCTAA
CCATGAGCGGATTGGCCAGCGGAGCTAGCCAGGATTCCAGCTCCAGTTGC
CACATGAAGTCCGAGTATGCGGCCAGTTATCCGGCTGATTTTGGTGCGGG
AACAGCCAGTTACGGTTATCCGCATCCACATCCGCACCATCACAATGCGT
GGGCAGCGGCCTATCATCCACATGCCACCGCC

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items