transcriptional Adaptor 1-2
Fly Line IDF004914
Construct IDP009510
CG/CR NumberCG31866
SymbolAda1-2
Gene Nametranscriptional Adaptor 1-2
Gene SynonymsAda1-2; CG31866; Ada1; ada1-2; dAda1
FBgnFBgn0051866
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGCTTACCGACAGAGTTCTGGCCACCAAGGAGGCGCTAGTGGTGGCTCT
GGGCGACAACTGGGAGCGTTACCGGGCCAACATGAAGAATTGGTTTCGGA
GCCGTTGGACTAAGGAGGAATTCGATGCGGAGTCGCGGAAAATCCTAACA
CCTGACAAACTGCACCTGCACAATCAGTTCCTGCTCGCCCTGCTCAACAA
GATCGACGCCTTTGCTCCCCTGGAGAATCCTCCGGCCGTCCAGACCAGCA
GCAGTAGTGGCAACCGAAGCAAACGGCGCAAAAGAAGTTCCCGCACCTTC
GCCGAACGCCTTAATTTTGAGCTCAGCGACGTCCTGGACTTTGTAGCCGA
GGACAACATGCAAATCATTCGTCCGCCAACCACGATCGGTATTCCGTCGG
ACCAGCAACAGCAACAGCTTCAGTCGCAGCGGTACTGCGCGCAGGAACTT
TTCCTGCCCGACGCGGGATTCATTATGGGACGATTTCTGATCGGTGCCTG
GGAAATCGGACTTGTCTCCGTGGACGACAATGTCGCCGAGTACGTTGCCA
TGGCCGTGCAAGTTCTGCTCAAGGATCTACTATCGGCAATCATCAAGAAA
CGAAAGCACTACAAGACCAGCGGCGAGGGAAACTTTTACTACGATGTAGG
TGCTCCGTTGCGTGATCCTTCGCTGCGCAACACCGTCACCCGGCAGAAGG
TCGACGACACGCCGCTGGAACTGGACAAGGAACTGAATACGGCCAACTTT
ATGCGGCGACAGAACGACGATGTGACCTTCCTCTCCGCCTGCGAAGAAGT
CCAACCCACCGAACGCACAGTAATCACCCTCAAGGACTGCCAACTGGCCT
TACGGGATCGCAACCTGATAGGCTCGCATGCCGTCTACTCTATAAACATG
GAACGACTCAATATGATGATGCAT

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items