nautilus
Fly Line IDF001893
Construct IDP003222
CG/CR NumberCG10250
Symbolnau
Gene Namenautilus
Gene SynonymsMyoD; MYOD; Dmyd; Mdrf; CG10250; nau; NAU; Nau
FBgnFBgn0002922
TypeORF-3xHA
PlasmidpGW-HA.attB
Sequence

ATGACCAAGTATAATAGTGGCAGCAGTGAAATGCCTGCGGCTCAAACCAT
CAAGCAGGAGTACCACAATGGCTATGGTCAGCCGACACATCCTGGATACG
GATTTAGCGCCTATAGCCAACAGAATCCGATAGCCCATCCCGGCCAGAAT
CCACACCAGACACTGCAGAATTTCTTTAGCCGCTTCAATGCCGTCGGTGA
TGCGAGTGCGGGAAATGGTGGAGCGGCTTCCATCTCAGCCAACGGATCGG
GTTCGTCTTGCAACTACAGTCATGCGAATCATcATCCGGcgGAGCTGGAC
AAGCCgTTGGGCATGAATATGACACCGTCGCCCATCTACACCACCGACTA
CGATGACGAGAACAGCAGTCTCAGCTCCGAGGAGCACGTCCTaGCGCCCC
TCGTCTGCTCCTCCGCCCAATCCTCCAGACCATGCCTCACCTGGGCCTGC
AAGGCGTGCAAAAAGAAGAGCGTCACCGTGGACCGTCGaAAAGCGGCCAC
TATGAGGGAACGCCGGAGACTGCGAAAGGTTAACGAGGCCTTCGAGATCC
TCAAGCGACGCACTTCATCCAATCCCAACCAGCGCCTGCCGAAGGTTGAG
ATATTGCGCAATGCCATCGAGTATATCGAGAGCCTGGAGGATCTGCTACA
GGAATCCAGTACCACACGCGATGGCGACAACCTGGCGCCCAGTTTGAGCG
GCAAAAGtTGCCAGTCCGATTATCTGAGCTCCTATGCTGGCGCTTATCTA
GAAGATAAACTTAGTTTTTACAACAAACATATGGAGAAATATGACTTTGA
TGGCAATGCCAATGGCTCCAGTTTGGACTGTCTAAATCTGATTGTTCAGA
GCATCAATAAGAGCACCACGAGTCCCATTCAAAATAAGGCCACGCCCTCC
GCTTCAGATACCCAgTCGCCGCCCTCATCCGGAGCAACTGCACCCACTTC
TCTGCACGTGAACTTCAAACGGAAGTGCAGCACT

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items