mir-13b-2
Fly Line IDF002030
Construct IDP003307
CG/CR NumberCR42972
Symbolmir-13b-2
Gene Namemir-13b-2
Gene Synonyms
FBgnFBgn0262421
TypemiRNA
PlasmidpWALIUM20
Sequence

TATTAACGCGTCAAAATGACTGTGAGCTATGTGGATTTGACTTCATATCA
CAGCCATTTTGACGAGTTTG

Insertion SiteChr.3, attP 86Fb
Comments
Log in to add this item

0 items