mir-9a
Fly Line IDF002018
Construct IDP003451
CG/CR NumberCR42891
Symbolmir-9a
Gene Namemir-9a
Gene Synonyms
FBgnFBgn0262373
TypemiRNA
PlasmidpWALIUM20
Sequence

GCTATGTTGTCTTTGGTTATCTAGCTGTATGAGTGATAAATAACGTCATA
AAGCTAGCTTACCGAAGTTAATATTAGC

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items