mir-1003
Fly Line IDF001981
Construct IDP003284
CG/CR NumberCR42987
Symbolmir-1003
Gene Namemir-1003
Gene Synonyms
FBgnFBgn0262431
TypemiRNA
PlasmidpWALIUM20
Sequence

GTGGGTATCTGGATGTGGTTGGCTCTGGCGGTCCTCTCACATTTACATAT
TCACAG

Insertion SiteChr.3, attP 86Fb
Comments
Temporary unavailable

0 items